Sanger Sequencing - core prep samples

business_center Service

The BRF will perform the reactions for you if you elect to use the "Core Prep" service.

Please provide templates and primers at the required concentration and volume in 200µL tubes.  Dilute DNA and primers in water.

Recommended stock concentrations

 PCR product <1kBPCR product >2 kB and ds plasmidMinimum volume
Template20-50 ng/µL100 ng/µL15 µL
Primer1.6 pmol/µL1.6 pmol/µL15 µL

If you sequence one template with, for example, three primers, please submit three times as much of the template (ie, 45 µL) in one tube.  Similarly, if one primer is to be used on three templates, submit three times as much of that primer (ie, 45µL) in one tube.

We have the following primers available at no extra charge:

  • Universal M13 Forward: GTAAAACGACGGCCAG
  • Universal M13 Reverse: CAGGAAACAGCTATGAC
  • T7: TAATACGACTCACTATAGGG
  • Sp6: ATTTAGGTGACACTATAG
  • T3: GCAATTAACCCTCACTAAAGG